Marking Scheme: +4 for correct answers, -1 for incorrect answers, 0 for unattempted questions. Options cannot be deselected.
Exam Summary
0 of 180 Questions completed
Questions:
Information
You have already completed the exam before. Hence you can not start it again.
Exam is loading…
You must sign in or sign up to start the exam.
You must first complete the following:
Results
Results
0 of 180 Questions answered correctly
Your time:
Time has elapsed
You have reached 0 of 0 point(s), (0)
Earned Point(s): 0 of 0, (0)
0 Essay(s) Pending (Possible Point(s): 0)
Average score |
|
Your score |
|
Categories
- BOTANY SECTION-A 0%
- BOTANY SECTION-B 0%
- CHEMISTRY SECTION-A 0%
- CHEMISTRY SECTION-B 0%
- Physics section-A 0%
- PHYSICS SECTION-B 0%
- ZOOLOGY SECTION-A 0%
- ZOOLOGY SECTION-B 0%
- 1
- 2
- 3
- 4
- 5
- 6
- 7
- 8
- 9
- 10
- 11
- 12
- 13
- 14
- 15
- 16
- 17
- 18
- 19
- 20
- 21
- 22
- 23
- 24
- 25
- 26
- 27
- 28
- 29
- 30
- 31
- 32
- 33
- 34
- 35
- 36
- 37
- 38
- 39
- 40
- 41
- 42
- 43
- 44
- 45
- 46
- 47
- 48
- 49
- 50
- 51
- 52
- 53
- 54
- 55
- 56
- 57
- 58
- 59
- 60
- 61
- 62
- 63
- 64
- 65
- 66
- 67
- 68
- 69
- 70
- 71
- 72
- 73
- 74
- 75
- 76
- 77
- 78
- 79
- 80
- 81
- 82
- 83
- 84
- 85
- 86
- 87
- 88
- 89
- 90
- 91
- 92
- 93
- 94
- 95
- 96
- 97
- 98
- 99
- 100
- 101
- 102
- 103
- 104
- 105
- 106
- 107
- 108
- 109
- 110
- 111
- 112
- 113
- 114
- 115
- 116
- 117
- 118
- 119
- 120
- 121
- 122
- 123
- 124
- 125
- 126
- 127
- 128
- 129
- 130
- 131
- 132
- 133
- 134
- 135
- 136
- 137
- 138
- 139
- 140
- 141
- 142
- 143
- 144
- 145
- 146
- 147
- 148
- 149
- 150
- 151
- 152
- 153
- 154
- 155
- 156
- 157
- 158
- 159
- 160
- 161
- 162
- 163
- 164
- 165
- 166
- 167
- 168
- 169
- 170
- 171
- 172
- 173
- 174
- 175
- 176
- 177
- 178
- 179
- 180
- Current
- Review
- Answered
- Correct
- Incorrect
-
Question 1 of 180
1. Question
4 point(s)Category: Physics section-AIn a series LCR circuit, the inductance $$L$$ is 10 mH , capacitance $$C$$ is $$1 \mu \mathrm{F}$$ and resistance $$R$$ is $$100 \Omega$$. The frequency at which resonance occurs is :-
CorrectIncorrect -
Question 2 of 180
2. Question
4 point(s)Category: Physics section-AThe magnitude and direction of the current in the following circuit is :-
CorrectIncorrect -
Question 3 of 180
3. Question
4 point(s)Category: Physics section-AIf the galvanometer $$G$$ does not show any deflection in the circuit shown, the value of $$R$$ is given by
CorrectIncorrect -
Question 4 of 180
4. Question
4 point(s)Category: Physics section-AThe temperature of a gas is $$-50^{\circ} \mathrm{C}$$. To what temperature the gas should be heated so that the rms speed is increased by 3 times?
CorrectIncorrect -
Question 5 of 180
5. Question
4 point(s)Category: Physics section-AThe ratio of radius of gyration of a solid sphere of mass $$M$$ and radius $$R$$ about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is :-
CorrectIncorrect -
Question 6 of 180
6. Question
4 point(s)Category: Physics section-AA Carnot engine has an efficiency of $$50 \%$$ when its source is at a temperature $$327^{\circ} \mathrm{C}$$. The temperature of the sink is :-
CorrectIncorrect -
Question 7 of 180
7. Question
4 point(s)Category: Physics section-AA bullet is fired from a gun at the speed of $$280 \mathrm{~ms}^{-1}$$ in the direction $$30^{\circ}$$ above the horizontal. The maximum height attained by the bullet is $$\left(\mathrm{g}=9.8 \mathrm{~ms}^{-2}, \sin 30^{\circ}=0.5\right)$$ :-
CorrectIncorrect -
Question 8 of 180
8. Question
4 point(s)Category: Physics section-AAn electric dipole is placed at an angle of $$30^{\circ}$$ with an electric field of intensity $$2 \times 10^{5} \mathrm{NC}^{-1}$$. It experiences a torque equal to 4 Nm . Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm .
CorrectIncorrect -
Question 9 of 180
9. Question
4 point(s)Category: Physics section-AGiven below are two statements:
Statement I : Photovoltaic devices can convert optical radiation into electricity.
Statement II : Zener diode is designed to operate under reverse bias in breakdown region.
In the light of the above statements, choose the most appropriate answer from the options given below :CorrectIncorrect -
Question 10 of 180
10. Question
4 point(s)Category: Physics section-AThe errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :
CorrectIncorrect -
Question 11 of 180
11. Question
4 point(s)Category: Physics section-AThe ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is:
CorrectIncorrect -
Question 12 of 180
12. Question
4 point(s)Category: Physics section-AThe net magnetic flux through any closed surface is :
CorrectIncorrect -
Question 13 of 180
13. Question
4 point(s)Category: Physics section-AThe work functions of Caesium $$(\mathrm{Cs})$$, potassium $$(\mathrm{K})$$ and Sodium (Na) are $$2.14 \mathrm{eV}, 2.30 \mathrm{eV}$$ and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV , which of these photosensitive surfaces may emit photoelectrons?
CorrectIncorrect -
Question 14 of 180
14. Question
4 point(s)Category: Physics section-AThe minimum wavelength of $$X$$-rays produced by an electron accelerated through a potential difference of $$V$$ volts is proportional to :
CorrectIncorrect -
Question 15 of 180
15. Question
4 point(s)Category: Physics section-AA $$12 \mathrm{~V}, 60 \mathrm{~W}$$ lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of 220 V . Assuming the transformer to be ideal, what is the current in the primary winding?
CorrectIncorrect -
Question 16 of 180
16. Question
4 point(s)Category: Physics section-ALight travels a distance x in time $$t_{1}$$ in air and 10x in time $$t_{2}$$ in another denser medium. What is the critical angle for this medium?
CorrectIncorrect -
Question 17 of 180
17. Question
4 point(s)Category: Physics section-AA metal wire has mass $$(0.4 \pm 0.002) \mathrm{g}$$, radius $$(0.3 \pm 0.001) \mathrm{mm}$$ and length $$(5 \pm 0.02) \mathrm{cm}$$. The maximum possible percentage error in the measurement of density will nearly be
CorrectIncorrect -
Question 18 of 180
18. Question
4 point(s)Category: Physics section-AFor Young’s double slit experiment, two statements are given below :
Statement I : If screen is moved away from the plane of slits, angular separation of the fringes remains constant.
Statement II : If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.
In the light of the above statements, choose the correct answer from the options given below :CorrectIncorrect -
Question 19 of 180
19. Question
4 point(s)Category: Physics section-AThe half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to $$\left(\frac{1}{16}\right)^{\text {th }}$$ of its initial value ?
CorrectIncorrect -
Question 20 of 180
20. Question
4 point(s)Category: Physics section-AThe equivalent capacitance of the system shown in the following circuit is :
CorrectIncorrect -
Question 21 of 180
21. Question
4 point(s)Category: Physics section-AResistance of a carbon resistor determined from colour codes is $$(22000 \pm 5 \%) \Omega$$. The colour of third band must be :
CorrectIncorrect -
Question 22 of 180
22. Question
4 point(s)Category: Physics section-AAn ac source is connected to a capacitor $$C$$. Due to decrease in its operating frequency:
CorrectIncorrect -
Question 23 of 180
23. Question
4 point(s)Category: Physics section-AA vehicle travels half the distance with speed $$v$$ and the remaining distance with speed $$2 v$$. Its average speed is :
CorrectIncorrect -
Question 24 of 180
24. Question
4 point(s)Category: Physics section-AThe amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly: (surface tension of soap solution $$=0.03 \mathrm{~N} \mathrm{~m}^{-1}$$ )
CorrectIncorrect -
Question 25 of 180
25. Question
4 point(s)Category: Physics section-AThe venturi-meter works on :
CorrectIncorrect -
Question 26 of 180
26. Question
4 point(s)Category: Physics section-AIn hydrogen spectrum, the shortest wavelength in the Balmer series is $$\lambda$$. The shortest wavelength in the Bracket series is :
CorrectIncorrect -
Question 27 of 180
27. Question
4 point(s)Category: Physics section-AThe potential energy of a long spring when stretched by 2 cm is $$U$$. If the spring is stretched by 8 cm , potential energy stored in it will be :
CorrectIncorrect -
Question 28 of 180
28. Question
4 point(s)Category: Physics section-AA full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
CorrectIncorrect -
Question 29 of 180
29. Question
4 point(s)Category: Physics section-AThe magnetic energy stored in an inductor of inductance $$4 \mu \mathrm{H}$$ carrying a current of 2 A is :
CorrectIncorrect -
Question 30 of 180
30. Question
4 point(s)Category: Physics section-AIf $$\oint_{s} \vec{E} . d \dot{S}=0$$ over a surface, then:
CorrectIncorrect -
Question 31 of 180
31. Question
4 point(s)Category: Physics section-AA football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :
CorrectIncorrect -
Question 32 of 180
32. Question
4 point(s)Category: Physics section-ALet a wire be suspended from the ceiling (rigid support) and stretched by a weight $$W$$ attached at its free end. The longitudinal stress at any point of cross-sectional area $$A$$ of the wire is :
CorrectIncorrect -
Question 33 of 180
33. Question
4 point(s)Category: Physics section-AThe angular acceleration of a body, moving along the circumference of a circle, is :
CorrectIncorrect -
Question 34 of 180
34. Question
4 point(s)Category: Physics section-AIn a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of $$2.0 \times 10^{10} \mathrm{~Hz}$$ and amplitude $$48 \mathrm{Vm}^{-1}$$. Then the amplitude of oscillating magnetic field is : (Speed of light in free space $$=3 \times 10^{8} \mathrm{~m} \mathrm{~s}^{-1}$$ )
CorrectIncorrect -
Question 35 of 180
35. Question
4 point(s)Category: Physics section-ATwo bodies of mass $$m$$ and 9 m are placed at a distance $$R$$. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be ( $$G=$$ gravitational constant) :
CorrectIncorrect -
Question 36 of 180
36. Question
4 point(s)Category: PHYSICS SECTION-BIn the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin)?
CorrectIncorrect -
Question 37 of 180
37. Question
4 point(s)Category: PHYSICS SECTION-BCalculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15 $$\left(\mathrm{g}=10 \mathrm{~m} \mathrm{~s}^{-2}\right.$$ ).
CorrectIncorrect -
Question 38 of 180
38. Question
4 point(s)Category: PHYSICS SECTION-BA satellite is orbiting just above the surface of the earth with period $$T$$. If $$d$$ is the density of the earth and $$G$$ is the universal constant of gravitation, the quantity $$\frac{3 \pi}{G d}$$ represents :
CorrectIncorrect -
Question 39 of 180
39. Question
4 point(s)Category: PHYSICS SECTION-BThe $$x$$-t graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at $$t=2 \mathrm{~s}$$ is :
CorrectIncorrect -
Question 40 of 180
40. Question
4 point(s)Category: PHYSICS SECTION-BFor the following logic circuit, the truth table is :
CorrectIncorrect -
Question 41 of 180
41. Question
4 point(s)Category: PHYSICS SECTION-BA horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity $$4 \mathrm{~m} \mathrm{~s}^{-1}$$. The ball strikes the water surface after 4 s . The height of bridge above water surface is (Take $$\mathrm{g}=10 \mathrm{~m} \mathrm{~s}^{-2}$$ )
CorrectIncorrect -
Question 42 of 180
42. Question
4 point(s)Category: PHYSICS SECTION-BTwo thin lenses are of same focal lengths ( $$f$$ ), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be :
CorrectIncorrect -
Question 43 of 180
43. Question
4 point(s)Category: PHYSICS SECTION-BA wire carrying a current $$I$$ along the positive $$x$$-axis has length $$L$$. It is kept in a magnetic field $$\overrightarrow{\mathrm{B}}=(2 \hat{\mathrm{i}}+3 \hat{\mathrm{j}}-4 \hat{\mathrm{k}}) \mathrm{T}$$. The magnitude of the magnetic force acting on the wire is :
CorrectIncorrect -
Question 44 of 180
44. Question
4 point(s)Category: PHYSICS SECTION-BA bullet from a gun is fired on a rectangular wooden block with velocity $$u$$. When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes $$\frac{u}{3}$$. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is :
CorrectIncorrect -
Question 45 of 180
45. Question
4 point(s)Category: PHYSICS SECTION-BThe resistance of platinum wire at $$0^{\circ} \mathrm{C}$$ is $$2 \Omega$$ and $$6.8 \Omega$$ at $$80^{\circ} \mathrm{C}$$. The temperature coefficient of resistance of the wire is :
CorrectIncorrect -
Question 46 of 180
46. Question
4 point(s)Category: CHEMISTRY SECTION-AGiven below are two statements : one is labelled as Assertion $$\mathbf{A}$$ and the other is labelled as Reason $$\mathbf{R}$$ :
Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic.
Reason $$\mathbf{R}$$ : The deep blue solution is due to the formation of amide.
In the light of the above statements, choose the correct answer from the options given below :CorrectIncorrect -
Question 47 of 180
47. Question
4 point(s)Category: CHEMISTRY SECTION-AThe conductivity of centimolar solution of KCl at $$25^{\circ} \mathrm{C}$$ is $$0.0210 \mathrm{ohm}^{-1} \mathrm{~cm}^{-1}$$ and the resistance of the cell containing the solution at $$25^{\circ} \mathrm{C}$$ is 60 ohm . The value of cell constant is –
CorrectIncorrect -
Question 48 of 180
48. Question
4 point(s)Category: CHEMISTRY SECTION-AFor a certain reaction, the rate $$=k[A]^{2}[B]$$, when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would
CorrectIncorrect -
Question 49 of 180
49. Question
4 point(s)Category: CHEMISTRY SECTION-AIdentify product $$(\mathrm{A})$$ is the following reaction :
CorrectIncorrect -
Question 50 of 180
50. Question
4 point(s)Category: CHEMISTRY SECTION-AWhich one is an example of heterogenous catalysis?
CorrectIncorrect -
Question 51 of 180
51. Question
4 point(s)Category: CHEMISTRY SECTION-AGiven below are two statements : one is labelled as
Assertion A and the other is labelled as Reason $$\mathbf{R}$$.
Assertion A : Helium is used to dilute oxygen in diving apparatus.
Reasons R : Helium has high solubility in $$\mathrm{O}_{2}$$.
In the light of the above statements, choose the
correct answer from the options given below :CorrectIncorrect -
Question 52 of 180
52. Question
4 point(s)Category: CHEMISTRY SECTION-AAmongst the following, the total number of species NOT having eight electrons around central atom in its outer most shell, is
$$\mathrm{NH}_{3}, \mathrm{AlCl}_{3}, \mathrm{BeCl}_{2}, \mathrm{CCl}_{4}, \mathrm{PCl}_{5}:$$CorrectIncorrect -
Question 53 of 180
53. Question
4 point(s)Category: CHEMISTRY SECTION-AThe correct order of energies of molecular orbitals of $$\mathrm{N}_{2}$$ molecule, is
CorrectIncorrect -
Question 54 of 180
54. Question
4 point(s)Category: CHEMISTRY SECTION-AMatch List-I with List-II.
Choose the correct answer from the options given below:CorrectIncorrect -
Question 55 of 180
55. Question
4 point(s)Category: CHEMISTRY SECTION-AThe number of $$\sigma$$ bonds, $$\pi$$ bonds and lone pair of electrons in pyridine, respectively are :
CorrectIncorrect -
Question 56 of 180
56. Question
4 point(s)Category: CHEMISTRY SECTION-AThe element expected to form largest ion to achieve the nearest noble gas configuration is
CorrectIncorrect -
Question 57 of 180
57. Question
4 point(s)Category: CHEMISTRY SECTION-AGiven below are two statements : one is labelled as Assertion A and the other is labelled as Reason $$\mathbf{R}$$.
Assertion A : A reaction can have zero activation energy.
Reasons R : The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.
In the light of the above statements, choose the
correct answer from the options given below:CorrectIncorrect -
Question 58 of 180
58. Question
4 point(s)Category: CHEMISTRY SECTION-AConsider the following reaction and identify the product $$(\mathrm{P})$$.
CorrectIncorrect -
Question 59 of 180
59. Question
4 point(s)Category: CHEMISTRY SECTION-AGiven below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : In equation $$\Delta_{r} G=-n F E_{\text {vell }}$$, value of $$\Delta_{\mathrm{r}} \mathrm{G}$$ depends on $$n$$.
Reasons R : $$\mathrm{E}_{\text {cell }}$$ is an intensive property and $$\Delta_{\mathrm{r}} \mathrm{G}$$ is an extensive property.
In the light of the above statements, choose the correct answer from the options given below :CorrectIncorrect -
Question 60 of 180
60. Question
4 point(s)Category: CHEMISTRY SECTION-AWhich amongst the following options is correct graphical representation of Boyle’s Law?
CorrectIncorrect -
Question 61 of 180
61. Question
4 point(s)Category: CHEMISTRY SECTION-AIn Lassaigne’s extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with $$\mathrm{Fe}^{3+}$$ due to the formation of
CorrectIncorrect -
Question 62 of 180
62. Question
4 point(s)Category: CHEMISTRY SECTION-AIdentify the product in the following reaction:
CorrectIncorrect -
Question 63 of 180
63. Question
4 point(s)Category: CHEMISTRY SECTION-ASelect the correct Statements from the following : A. Atoms of all elements are composed of two fundamental particles.
B. The mass of the electron is $$9.10939 \times 10^{-31} \mathrm{~kg}$$.
C. All the isotopes of a given elements show same chemical properties.
D. Protons and electrons are collectively known as nucleons.
E. Dalton’s atomic theory, regarded the atom as an ultimate particle of matter.
Choose the correct answer from the options given below.CorrectIncorrect -
Question 64 of 180
64. Question
4 point(s)Category: CHEMISTRY SECTION-AA compound is formed by two elements A and B. The elements B forms cubic close packed structure and atoms of $$A$$ occupy $$1 / 3$$ of tetrahedral voids. If the formula of the compound is $$\mathrm{A}_{\mathrm{x}} \mathrm{B}_{\mathrm{y}}$$, then the value of $$x+y$$ is in option
CorrectIncorrect -
Question 65 of 180
65. Question
4 point(s)Category: CHEMISTRY SECTION-AGiven below are two statements:
Statement I : A unit formed by the attachment of a base to l’ position of sugar is known as nucleoside
Statement II : When nucleoside is linked to phosphorous acid at 5′-position of sugar moiety, we get nucleotide.
In the light of the above statements, choose the correct answer from the options given below:CorrectIncorrect -
Question 66 of 180
66. Question
4 point(s)Category: CHEMISTRY SECTION-AWhich amongst the following molecules on polymerization produces neoprene?
CorrectIncorrect -
Question 67 of 180
67. Question
4 point(s)Category: CHEMISTRY SECTION-ATaking stability as the factor, which one of the following represents correct relationship?
CorrectIncorrect -
Question 68 of 180
68. Question
4 point(s)Category: CHEMISTRY SECTION-ASome tranquilizers are listed below. Which one from the following belongs to barbiturates?
CorrectIncorrect -
Question 69 of 180
69. Question
4 point(s)Category: CHEMISTRY SECTION-AWhich of the following statements are NOT correct?
A. Hydrogen is used to reduce heavy metal oxides to metals.
B. Heavy water is used to study reaction mechanism.
C. Hydrogen is used to make saturated fats from oils
D. The H-H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any element.
E. Hydrogen reduces oxides of metals that are more active than iron.
Choose the most appropriate answer from the options given below:CorrectIncorrect -
Question 70 of 180
70. Question
4 point(s)Category: CHEMISTRY SECTION-AIntermolecular forces are forces of attraction and repulsion between interacting particles that will include:
A. dipole – dipole forces.
B. dipole – induced dipole forces
C. hydrogen bonding
D. covalent bonding
E. dispersion forcesChoose the most appropriate answer from the options given below :
CorrectIncorrect -
Question 71 of 180
71. Question
4 point(s)Category: CHEMISTRY SECTION-AAmongst the given options which of the following molecules/ion acts as a Lewis acid?
CorrectIncorrect -
Question 72 of 180
72. Question
4 point(s)Category: CHEMISTRY SECTION-AThe right option for the mass of $$\mathrm{CO}_{2}$$ produced by heating 20 g of $$20 \%$$ pure limestone is
(Atomic $${ }^{\text {mass }}$$ of $$\mathrm{Ca}=40$$ )
$$\left[\mathrm{CaCO}_{3}{ }^{1200 \mathrm{~K}} \quad \mathrm{CaO}+\mathrm{CO}_{2}\right]$$CorrectIncorrect -
Question 73 of 180
73. Question
4 point(s)Category: CHEMISTRY SECTION-AThe relation between $$n_{\mathrm{m}},\left(\mathrm{n}_{\mathrm{u}}=\right.$$ the number of permissible values of magnetic quantum number ( m )) for a given value of azimuthal quantum number ( ), is
CorrectIncorrect -
Question 74 of 180
74. Question
4 point(s)Category: CHEMISTRY SECTION-AThe stability of $$\mathrm{Cu}^{2+}$$ is more than $$\mathrm{Cu}^{+}$$salts in aqueous solution due to –
CorrectIncorrect -
Question 75 of 180
75. Question
4 point(s)Category: CHEMISTRY SECTION-AWhich one of the following statements is correct?
CorrectIncorrect -
Question 76 of 180
76. Question
4 point(s)Category: CHEMISTRY SECTION-AWhich of the following reactions will NOT give primary amine as the product?
CorrectIncorrect -
Question 77 of 180
77. Question
4 point(s)Category: CHEMISTRY SECTION-AThe given compound:
CorrectIncorrect -
Question 78 of 180
78. Question
4 point(s)Category: CHEMISTRY SECTION-AComplete the following reaction:
$$[C]$$ is $$\qquad$$
CorrectIncorrect -
Question 79 of 180
79. Question
4 point(s)Category: CHEMISTRY SECTION-AHomoleptic complex from the following complexes is :
CorrectIncorrect -
Question 80 of 180
80. Question
4 point(s)Category: CHEMISTRY SECTION-AWeight $$(\mathrm{g})$$ of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is :
CorrectIncorrect -
Question 81 of 180
81. Question
4 point(s)Category: CHEMISTRY SECTION-BConsider the following reaction
CorrectIncorrect -
Question 82 of 180
82. Question
4 point(s)Category: CHEMISTRY SECTION-BWhich amongst the following will be most readily dehydrated under acidic conditions?
CorrectIncorrect -
Question 83 of 180
83. Question
4 point(s)Category: CHEMISTRY SECTION-BThe equilibrium concentrations of the species in the reaction $$\mathrm{A}+\mathrm{B} \rightleftharpoons \mathrm{C}+\mathrm{D}$$ are $$2,3,10$$ and 6 mol $$\mathrm{L}^{-1}$$, respectively at $$300 \mathrm{~K} . \Delta \mathrm{G}^{0}$$ for the reaction is ( $$\mathrm{R}=2 \mathrm{cal} / \mathrm{mol} \mathrm{K}$$ )
CorrectIncorrect -
Question 84 of 180
84. Question
4 point(s)Category: CHEMISTRY SECTION-BGiven below are two statements :
Statement I : The nutrient deficient water bodies lead to eutrophication.
Statement II : Eutrophication leads to decrease in the level of oxygen in the water bodies.
In the light of the above statements, choose the correct answer from the options given below :CorrectIncorrect -
Question 85 of 180
85. Question
4 point(s)Category: CHEMISTRY SECTION-BWhich among the following options is the correct relation between change in enthalpy $$\mu y$$ and change in internal energy?
CorrectIncorrect -
Question 86 of 180
86. Question
4 point(s)Category: CHEMISTRY SECTION-BMatch List I with List II with respect to human eye.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 87 of 180
87. Question
4 point(s)Category: CHEMISTRY SECTION-BIdentify the major product obtained in the following reaction:
CorrectIncorrect -
Question 88 of 180
88. Question
4 point(s)Category: CHEMISTRY SECTION-BPumice stone is an example of –
CorrectIncorrect -
Question 89 of 180
89. Question
4 point(s)Category: CHEMISTRY SECTION-BThe reaction that does NOT take place in blast furnace between 900 K to 1500 K temperature range during extraction of iron is :
CorrectIncorrect -
Question 90 of 180
90. Question
4 point(s)Category: CHEMISTRY SECTION-BWhich of the following statements are incorrect: A. All the transition metals except scandium form MO oxides which are ionic.
B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in $$\mathrm{Sc}_{2} \mathrm{O}_{3}$$ to $$\mathrm{Mn}_{2} \mathrm{O}_{7}$$.
C. Basic character increases from $$\mathrm{V}_{2} \mathrm{O}_{3}$$ to $$\mathrm{V}_{2} \mathrm{O}_{4}$$ to $$\mathrm{V}_{2} \mathrm{O}_{5}$$.
D. $$\mathrm{V}_{2} \mathrm{O}_{4}$$ dissolves in acids to give $$\mathrm{VO}_{4}^{3-}$$ salts.
E. CrO is basic but $$\mathrm{Cr}_{2} \mathrm{O}_{3}$$ is amphoteric.Choose the correct answer from the options given below:
CorrectIncorrect -
Question 91 of 180
91. Question
4 point(s)Category: BOTANY SECTION-AMovement and accumulation of ions across a membrane against their concentration gradient can be explained by
CorrectIncorrect -
Question 92 of 180
92. Question
4 point(s)Category: BOTANY SECTION-AAmong ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?
CorrectIncorrect -
Question 93 of 180
93. Question
4 point(s)Category: BOTANY SECTION-AIdentify the pair of heterosporous pteridophytes among the following :
CorrectIncorrect -
Question 94 of 180
94. Question
4 point(s)Category: BOTANY SECTION-AFrequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
CorrectIncorrect -
Question 95 of 180
95. Question
4 point(s)Category: BOTANY SECTION-AWhat is the function of tassels in the corn cob ?
CorrectIncorrect -
Question 96 of 180
96. Question
4 point(s)Category: BOTANY SECTION-AIdentify the correct statements:
A. Detrivores perform fragmentation.
B. The humus is further degraded by some microbes during mineralization.
C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching.
D. The detritus food chain begins with living organisms.
E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the option given below:CorrectIncorrect -
Question 97 of 180
97. Question
4 point(s)Category: BOTANY SECTION-AGiven below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : Late wood has fewer xylary elementswith narrow vessels.
Reason R : Cambium is less active in winters.
In the light of the above statements, choose the correct answer from the options given below :CorrectIncorrect -
Question 98 of 180
98. Question
4 point(s)Category: BOTANY SECTION-AThe process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
CorrectIncorrect -
Question 99 of 180
99. Question
4 point(s)Category: BOTANY SECTION-AWhich of the following stages of meiosis involves division of centromere ?
CorrectIncorrect -
Question 100 of 180
100. Question
4 point(s)Category: BOTANY SECTION-ADuring the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
CorrectIncorrect -
Question 101 of 180
101. Question
4 point(s)Category: BOTANY SECTION-AFamily Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family. Fabaceae but not found in Solanaceae or Liliaceae.
CorrectIncorrect -
Question 102 of 180
102. Question
4 point(s)Category: BOTANY SECTION-ALarge, colourful, fragrant flowers with nectar are seen in:
CorrectIncorrect -
Question 103 of 180
103. Question
4 point(s)Category: BOTANY SECTION-ASpraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
CorrectIncorrect -
Question 104 of 180
104. Question
4 point(s)Category: BOTANY SECTION-AAxile placentation is observed in
CorrectIncorrect -
Question 105 of 180
105. Question
4 point(s)Category: BOTANY SECTION-AAmong eukaryotes, replication of DNA takes place in –
CorrectIncorrect -
Question 106 of 180
106. Question
4 point(s)Category: BOTANY SECTION-AHow many ATP and $$\mathrm{NADPH}_{2}$$ are required for the synthesis of one molecule of Glucose during Calvin cycle?
CorrectIncorrect -
Question 107 of 180
107. Question
4 point(s)Category: BOTANY SECTION-AIn gene gun method used to introduce alien DNA into host cells, microparticles of metal are used.
CorrectIncorrect -
Question 108 of 180
108. Question
4 point(s)Category: BOTANY SECTION-AThe thickness of ozone in a column of air in the atmosphere is measured in terms of :
CorrectIncorrect -
Question 109 of 180
109. Question
4 point(s)Category: BOTANY SECTION-AUnequivocal proof that DNA is the genetic material was first proposed by
CorrectIncorrect -
Question 110 of 180
110. Question
4 point(s)Category: BOTANY SECTION-AIn the equation
$$
G P P-R=N P P
$$GPP is Gross Primary Productivity
NPP is Net Primary Productivity
$$R$$ here is $$\qquad$$ .CorrectIncorrect -
Question 111 of 180
111. Question
4 point(s)Category: BOTANY SECTION-AWhat is the role of RNA polymerase III in the process of transcription in Eukaryotes?
CorrectIncorrect -
Question 112 of 180
112. Question
4 point(s)Category: BOTANY SECTION-AWhich micronutrient is required for splitting of water molecule during photosynthesis?
CorrectIncorrect -
Question 113 of 180
113. Question
4 point(s)Category: BOTANY SECTION-AIn angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are:
CorrectIncorrect -
Question 114 of 180
114. Question
4 point(s)Category: BOTANY SECTION-AThe phenomenon of pleiotropism refers to
CorrectIncorrect -
Question 115 of 180
115. Question
4 point(s)Category: BOTANY SECTION-AGiven below are two statements: One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : ATP is used at two steps in glycolysis.
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-16-diphosphate.
In the light of the above statements, choose the correct answer from the options given below :CorrectIncorrect -
Question 116 of 180
116. Question
4 point(s)Category: BOTANY SECTION-ACellulose does not form blue colour with Iodine because
CorrectIncorrect -
Question 117 of 180
117. Question
4 point(s)Category: BOTANY SECTION-AWhich hormone promotes internode/petiole elongation in deep water rice?
CorrectIncorrect -
Question 118 of 180
118. Question
4 point(s)Category: BOTANY SECTION-AExpressed Sequence Tags (ESTs) refers to
CorrectIncorrect -
Question 119 of 180
119. Question
4 point(s)Category: BOTANY SECTION-AGiven below are two statements :
Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling.
In the light of the above statements, choose the most appropriate answer from the options given below:CorrectIncorrect -
Question 120 of 180
120. Question
4 point(s)Category: BOTANY SECTION-AUpon exposure to UV radiation, DNA stained with ethidium bromide will show
CorrectIncorrect -
Question 121 of 180
121. Question
4 point(s)Category: BOTANY SECTION-AThe historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year:
CorrectIncorrect -
Question 122 of 180
122. Question
4 point(s)Category: BOTANY SECTION-AThe reaction centre in PS II has an absorption maxima at
CorrectIncorrect -
Question 123 of 180
123. Question
4 point(s)Category: BOTANY SECTION-AGiven below are two statements: One is labelled as Assertion $$\mathbf{A}$$ and the other is labelled as Reason $$\mathbf{R}$$ : Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from the options given below:CorrectIncorrect -
Question 124 of 180
124. Question
4 point(s)Category: BOTANY SECTION-AIn tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as:
CorrectIncorrect -
Question 125 of 180
125. Question
4 point(s)Category: BOTANY SECTION-AGiven below are two statements:
Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II : Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer from the options given below;CorrectIncorrect -
Question 126 of 180
126. Question
4 point(s)Category: BOTANY SECTION-BIdentify the correct statements:
A. Lenticels are the lens-shaped openings permitting the exchange of gases.
B. Bark formed early in the season is called hard bark.
C. Bark is a technical term that refers to all tissues exterior to vascular cambium.
D. Bark refers to periderm and secondary phloem.
E. Phellogen is single-layered in thickness.Choose the correct answer from the options given below:
CorrectIncorrect -
Question 127 of 180
127. Question
4 point(s)Category: BOTANY SECTION-BMatch List I with List II :
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 128 of 180
128. Question
4 point(s)Category: BOTANY SECTION-BMatch List I with List II:
Choose the correct answer from the options given below:
CorrectIncorrect -
Question 129 of 180
129. Question
4 point(s)Category: BOTANY SECTION-BWhich of the following statements are correct about Klinefelter’sSyndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also expressed.
C. The affected individual is shortstatured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.Choose the correct answer from the options given below:
CorrectIncorrect -
Question 130 of 180
130. Question
4 point(s)Category: BOTANY SECTION-BGiven below are two statements :
Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.
Statement II : In general, carnivores are more adversely affected by competition than herbivores. In the light of the above statements, choose the correct answer from the options given below:CorrectIncorrect -
Question 131 of 180
131. Question
4 point(s)Category: BOTANY SECTION-BHow many different proteins does the ribosome consist of?
CorrectIncorrect -
Question 132 of 180
132. Question
4 point(s)Category: BOTANY SECTION-BWhich of the following combinations is required for chemiosmosis?
CorrectIncorrect -
Question 133 of 180
133. Question
4 point(s)Category: BOTANY SECTION-BWhich one of the following statements is NOT correct?
CorrectIncorrect -
Question 134 of 180
134. Question
4 point(s)Category: BOTANY SECTION-BMatch List I with List II :
Choose the correct answer from the options given below:
CorrectIncorrect -
Question 135 of 180
135. Question
4 point(s)Category: BOTANY SECTION-BMain steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.
A. Insertion of recombinant DNA into the host cell.
B. Cutting of DNA at specific location by restriction enzyme.
C. Isolation of desired DNA fragment.
D. Amplification of gene of interest using PCR.Choose the correct answer from the options given below:
CorrectIncorrect -
Question 136 of 180
136. Question
4 point(s)Category: ZOOLOGY SECTION-AGiven below are two statements:
Statement I : A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid $$(\mathrm{N}$$ terminal).
Statement II : Adult human haemoglobin, consists of 4 subunits (two subunits of $$\alpha$$ type and two subunits $$\beta$$ type.)
In the light of the above statements, choose the correct answer from the options given below :CorrectIncorrect -
Question 137 of 180
137. Question
4 point(s)Category: ZOOLOGY SECTION-ARadial symmetry is NOT found in adults of phylum $$\qquad$$
CorrectIncorrect -
Question 138 of 180
138. Question
4 point(s)Category: ZOOLOGY SECTION-AWhich of the following statements are correct regarding female reproductive cycle ?A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
B. First menstrual cycle begins at puberty and is called menopause.
C. Lack of menstruation may be indicative of pregnancy.
D. Cyclic menstruation extends between menarche and menopause.
Choose the most appropriate answer from the options given below :CorrectIncorrect -
Question 139 of 180
139. Question
4 point(s)Category: ZOOLOGY SECTION-AGiven below are statements : one is labelled as
Assertion A and the other is labelled as Reason R.
Assertion A : Nephrons are of two types : Cortical \& Juxta medullary, based on their relative position in cortex and medulla.
Reason R : Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle.
In the light of the above statements, choose the correct answer from the options given below :CorrectIncorrect -
Question 140 of 180
140. Question
4 point(s)Category: ZOOLOGY SECTION-AMatch List I with List II with respect to human eye.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 141 of 180
141. Question
4 point(s)Category: ZOOLOGY SECTION-AWhich of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic Reticulum
C. Chloroplasts
D. Golgi complex
E. PeroxisomesChoose the most appropriate answer from the options given below :
CorrectIncorrect -
Question 142 of 180
142. Question
4 point(s)Category: ZOOLOGY SECTION-ABroad palm with single palm crease is visible in a person suffering from –
CorrectIncorrect -
Question 143 of 180
143. Question
4 point(s)Category: ZOOLOGY SECTION-AMatch List I with List II.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 144 of 180
144. Question
4 point(s)Category: ZOOLOGY SECTION-AWhich one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
CorrectIncorrect -
Question 145 of 180
145. Question
4 point(s)Category: ZOOLOGY SECTION-AMatch List I with List II.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 146 of 180
146. Question
4 point(s)Category: ZOOLOGY SECTION-AGiven below are two statements : one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : Endometrium is necessary for implantation of blastocyst.
Reason R : In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.
In the light of the above statements, choose the correct answer from the options given below :CorrectIncorrect -
Question 147 of 180
147. Question
4 point(s)Category: ZOOLOGY SECTION-AWhich of the following is not a cloning vector?
CorrectIncorrect -
Question 148 of 180
148. Question
4 point(s)Category: ZOOLOGY SECTION-AMatch List I with List II.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 149 of 180
149. Question
4 point(s)Category: ZOOLOGY SECTION-AGiven below are two statements :
Statement I : Ligaments are dense irregular tissue.
Statement II : Cartilage is dense regular tissue.
In the light of the above statements, choose the correct answer from the options given below :CorrectIncorrect -
Question 150 of 180
150. Question
4 point(s)Category: ZOOLOGY SECTION-AWhich of the following functions is carried out by cytoskeleton in a cell?
CorrectIncorrect -
Question 151 of 180
151. Question
4 point(s)Category: ZOOLOGY SECTION-AMatch List I with List II.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 152 of 180
152. Question
4 point(s)Category: ZOOLOGY SECTION-AWhich of the following statements is correct?
CorrectIncorrect -
Question 153 of 180
153. Question
4 point(s)Category: ZOOLOGY SECTION-AWhich one of the following symbols represents mating between relatives in human pedigree analysis?
CorrectIncorrect -
Question 154 of 180
154. Question
4 point(s)Category: ZOOLOGY SECTION-AOnce the undigested and unabsorbed substances enter the caecum, their backflow is prevented by –
CorrectIncorrect -
Question 155 of 180
155. Question
4 point(s)Category: ZOOLOGY SECTION-AWhich one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
CorrectIncorrect -
Question 156 of 180
156. Question
4 point(s)Category: ZOOLOGY SECTION-AGiven below are two statements :
Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II : When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the correct answer from the options given below:CorrectIncorrect -
Question 157 of 180
157. Question
4 point(s)Category: ZOOLOGY SECTION-AMatch List I with List II.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 158 of 180
158. Question
4 point(s)Category: ZOOLOGY SECTION-AGiven below are two statements :
Statement I : Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.
Statement II : The cavity of the cervix is called cervical canal which along with vagina forms birth canal.
In the light of the above statements, choose the correct answer from the options given below:CorrectIncorrect -
Question 159 of 180
159. Question
4 point(s)Category: ZOOLOGY SECTION-AIn which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
CorrectIncorrect -
Question 160 of 180
160. Question
4 point(s)Category: ZOOLOGY SECTION-AMatch List I with List II.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 161 of 180
161. Question
4 point(s)Category: ZOOLOGY SECTION-AVital capacity of lung is $$\qquad$$ .
CorrectIncorrect -
Question 162 of 180
162. Question
4 point(s)Category: ZOOLOGY SECTION-ASelect the correct group/set of Australian Marsupials exhibiting adaptive radiation.
CorrectIncorrect -
Question 163 of 180
163. Question
4 point(s)Category: ZOOLOGY SECTION-AMatch List I with List II.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 164 of 180
164. Question
4 point(s)Category: ZOOLOGY SECTION-AGiven below are two statements: one is labelled as
Assertion A and the other is labelled as Reason R.
Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme.
Reason R : Ban on amniocentesis checks increasing menace of female foeticide.
In the light of the above statements, choose the correct answer from the options given below :CorrectIncorrect -
Question 165 of 180
165. Question
4 point(s)Category: ZOOLOGY SECTION-AGiven below are two statements:
Statement I : RNA mutates at a faster rate.
Statement II : Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below :CorrectIncorrect -
Question 166 of 180
166. Question
4 point(s)Category: ZOOLOGY SECTION-AMatch List I with List II.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 167 of 180
167. Question
4 point(s)Category: ZOOLOGY SECTION-AGiven below are two statements:
Statement I : Electrostatic precipitator is most widely used in thermal power plant.
Statement II : Electrostatic precipitator in thermal power plant removes ionising radiations
In the light of the above statements, choose the most appropriate answer from the options given below :CorrectIncorrect -
Question 168 of 180
168. Question
4 point(s)Category: ZOOLOGY SECTION-AGiven below are two statements:
Statement I : In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II : In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below :CorrectIncorrect -
Question 169 of 180
169. Question
4 point(s)Category: ZOOLOGY SECTION-AMatch List I with List II.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 170 of 180
170. Question
4 point(s)Category: ZOOLOGY SECTION-AMatch List I with List II.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 171 of 180
171. Question
4 point(s)Category: ZOOLOGY SECTION-BWhich of the following statements are correct?
A. Basophils are most abundant cells of the total WBCs
B. Basophils secrete histamine, serotonin and heparin
C. Basophils are involved in inflammatory response
D. Basophils have kidney shaped nucleus
E. Basophils are agranulocytesChoose the correct answer from the options given below:
CorrectIncorrect -
Question 172 of 180
172. Question
4 point(s)Category: ZOOLOGY SECTION-BMatch List I with List II.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 173 of 180
173. Question
4 point(s)Category: ZOOLOGY SECTION-BSelect the correct statements.
A. Tetrad formation is seen during Leptotene.
B. During Anaphase, the centromeres split and chromatids separate.
C. Terminalization takes place during Pachytene.
D. Nucleolus, Golgi complex and ER are reformed during Telophase.
E. Crossing over takes place between sister chromatids of homologous chromosome.
Choose the correct answer from the options given below:CorrectIncorrect -
Question 174 of 180
174. Question
4 point(s)Category: ZOOLOGY SECTION-BIn cockroach, excretion is brought about by-
A. Phallic gland
B. Urecose gland
C. Nephrocytes
D. Fat body
E. Collaterial glandsChoose the correct answer from the options given below:
CorrectIncorrect -
Question 175 of 180
175. Question
4 point(s)Category: ZOOLOGY SECTION-BGiven below are two statements:
Statement I : During $$G_{0}$$ phase of cell cycle, the cell is metabolically inactive.
Statement II : The centrosome undergoes duplication during $$S$$ phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below :CorrectIncorrect -
Question 176 of 180
176. Question
4 point(s)Category: ZOOLOGY SECTION-BSelect the correct statements with reference to chordates.
A. Presence of mid-dorsal, solid and double nerve cord.
B. Presence of closed circulatory system
C. Presence of paired pharyngeal gillslits
D. Presence of dorsal heart
E. Triploblastic pseudocoelomate animalsChoose the correct answer from the options given below:
CorrectIncorrect -
Question 177 of 180
177. Question
4 point(s)Category: ZOOLOGY SECTION-BMatch List I with List II.
Choose the correct answer from the options given below :
CorrectIncorrect -
Question 178 of 180
178. Question
4 point(s)Category: ZOOLOGY SECTION-BWhich one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5′ AUCGAUCGAUCGAUCGAUCG AUCG
AUCG 3′?CorrectIncorrect -
Question 179 of 180
179. Question
4 point(s)Category: ZOOLOGY SECTION-BWhich of the following is characteristic feature of cockroach regarding sexual dimorphism?
CorrectIncorrect -
Question 180 of 180
180. Question
4 point(s)Category: ZOOLOGY SECTION-BWhich of the following statements are correct regarding skeletal muscle?
A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
D. M line is considered as functional unit of contraction called sarcomere.
Choose the most appropriate answer from the options given below:CorrectIncorrect